ID: 946940562_946940566

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 946940562 946940566
Species Human (GRCh38) Human (GRCh38)
Location 2:224765750-224765772 2:224765798-224765820
Sequence CCGTGGGTAGGGCCGGAGTTGCT GGTCCACTCCGCGCTTTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163} {0: 1, 1: 0, 2: 0, 3: 4, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!