ID: 946942473_946942479

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 946942473 946942479
Species Human (GRCh38) Human (GRCh38)
Location 2:224784114-224784136 2:224784148-224784170
Sequence CCTTTCTCCATCTCTGGAGACTT TTGGGTAAAGATTTATTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 395} {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!