|
Left Crispr |
Right Crispr |
| Crispr ID |
947009273 |
947009285 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:225547616-225547638
|
2:225547666-225547688
|
| Sequence |
CCCACAATCACTATACTCTCCTT |
ATGTGGCCACTGCTGGGGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 26, 3: 92, 4: 329} |
{0: 4, 1: 8, 2: 29, 3: 156, 4: 609} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|