ID: 947013433_947013444

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 947013433 947013444
Species Human (GRCh38) Human (GRCh38)
Location 2:225591070-225591092 2:225591110-225591132
Sequence CCAGATGAGTCCAGGCTTTTGGA AGCATGGCGGGCCCTCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150} {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!