ID: 947048894_947048902

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 947048894 947048902
Species Human (GRCh38) Human (GRCh38)
Location 2:226019821-226019843 2:226019839-226019861
Sequence CCTCCCACAGCATTCCTCCCATA CCATAACACGTGAGGATTATGGG
Strand - +
Off-target summary No data {0: 1, 1: 38, 2: 646, 3: 3157, 4: 6454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!