ID: 947109115_947109121

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 947109115 947109121
Species Human (GRCh38) Human (GRCh38)
Location 2:226699516-226699538 2:226699553-226699575
Sequence CCTGCCTGCTAGGACTGTTCTAG GGGTCCAGTTGTTGTCTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!