ID: 947120319_947120327

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 947120319 947120327
Species Human (GRCh38) Human (GRCh38)
Location 2:226807583-226807605 2:226807633-226807655
Sequence CCCTGACTGGAGGGCATTTGGCA CAGTGGGAGCAGAGTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210} {0: 1, 1: 1, 2: 6, 3: 107, 4: 860}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!