ID: 947156281_947156290

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 947156281 947156290
Species Human (GRCh38) Human (GRCh38)
Location 2:227164955-227164977 2:227164987-227165009
Sequence CCCGGGACAGGCAGCGAGCGGAA CGGGGATGCCCCGGAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 133} {0: 1, 1: 0, 2: 1, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!