ID: 947202266_947202269

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947202266 947202269
Species Human (GRCh38) Human (GRCh38)
Location 2:227624764-227624786 2:227624781-227624803
Sequence CCAGGCTGCGTGAACCCTATAGT TATAGTGAATTGTGCGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47} {0: 1, 1: 0, 2: 30, 3: 296, 4: 812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!