ID: 947229543_947229548

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947229543 947229548
Species Human (GRCh38) Human (GRCh38)
Location 2:227871428-227871450 2:227871445-227871467
Sequence CCGGCCATGCCTAGCTCCTCTGA CTCTGAGGTCGCCCTTAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 219} {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!