ID: 947233857_947233860

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 947233857 947233860
Species Human (GRCh38) Human (GRCh38)
Location 2:227919910-227919932 2:227919931-227919953
Sequence CCTTTCTGCTTCTGCACCTACAG AGCTGGTGATCATTGCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 337} {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!