ID: 947241267_947241274

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 947241267 947241274
Species Human (GRCh38) Human (GRCh38)
Location 2:227996929-227996951 2:227996962-227996984
Sequence CCTGTAGATGAAGATCCAGAAGC TGGAGGGCTTATCCTGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141} {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!