ID: 947328299_947328309

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 947328299 947328309
Species Human (GRCh38) Human (GRCh38)
Location 2:229001674-229001696 2:229001726-229001748
Sequence CCCACAACTCATATATTGAAGCC TGGGGCTTTCGGCAGGTAATTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 59, 3: 499, 4: 1590} {0: 1, 1: 0, 2: 7, 3: 39, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!