ID: 947344986_947344992

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947344986 947344992
Species Human (GRCh38) Human (GRCh38)
Location 2:229181131-229181153 2:229181148-229181170
Sequence CCTTCACCCTCCAGCTAATTCTG ATTCTGATATGGGATAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 275} {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!