ID: 947374195_947374200

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 947374195 947374200
Species Human (GRCh38) Human (GRCh38)
Location 2:229479261-229479283 2:229479275-229479297
Sequence CCCTGTGTCCAAGCCCTTTCACA CCTTTCACACAGTCCGCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 18, 4: 255} {0: 1, 1: 0, 2: 0, 3: 0, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!