ID: 947377292_947377299

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 947377292 947377299
Species Human (GRCh38) Human (GRCh38)
Location 2:229509669-229509691 2:229509701-229509723
Sequence CCGGGCATGGTAGTGGGTGCCTG CTACTTAGGAGGGCTGAAGCAGG
Strand - +
Off-target summary {0: 88, 1: 2675, 2: 13722, 3: 42751, 4: 82272} {0: 1, 1: 3, 2: 89, 3: 611, 4: 2178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!