|
Left Crispr |
Right Crispr |
| Crispr ID |
947377294 |
947377299 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:229509688-229509710
|
2:229509701-229509723
|
| Sequence |
CCTGTAATCCCTGCTACTTAGGA |
CTACTTAGGAGGGCTGAAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 3179, 2: 110890, 3: 242985, 4: 268248} |
{0: 1, 1: 3, 2: 89, 3: 611, 4: 2178} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|