ID: 947392759_947392765

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 947392759 947392765
Species Human (GRCh38) Human (GRCh38)
Location 2:229655986-229656008 2:229656000-229656022
Sequence CCTCCTCTAGACCCTAGAGTGTC TAGAGTGTCTGGAGGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89} {0: 1, 1: 0, 2: 3, 3: 35, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!