ID: 947404964_947404975

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 947404964 947404975
Species Human (GRCh38) Human (GRCh38)
Location 2:229765881-229765903 2:229765921-229765943
Sequence CCCCCAACTCCTCTGACAGTTCC CACTGCCCAAGTGAACTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 281} {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!