ID: 947408645_947408647

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 947408645 947408647
Species Human (GRCh38) Human (GRCh38)
Location 2:229809671-229809693 2:229809698-229809720
Sequence CCAATCTTATTTAGGGAAAGAGC TCTTCAGGACCACTCAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123} {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!