ID: 947432754_947432763

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 947432754 947432763
Species Human (GRCh38) Human (GRCh38)
Location 2:230045128-230045150 2:230045181-230045203
Sequence CCACCTTCAAATGGGTAAGGAGC ATTTCCTCACTCTACCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82} {0: 1, 1: 0, 2: 2, 3: 11, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!