ID: 947443076_947443079 |
View in Genome Browser |
Spacer: 4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 947443076 | 947443079 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:230140365-230140387 | 2:230140392-230140414 |
| Sequence | CCTAGAGACTTGTTGAGTGGTTG | CAAAATGCTGATAGTGATATGGG |
| Strand | - | + |
| Off-target summary | {0: 4, 1: 87, 2: 582, 3: 2203, 4: 2074} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||