ID: 947485056_947485059

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 947485056 947485059
Species Human (GRCh38) Human (GRCh38)
Location 2:230540370-230540392 2:230540398-230540420
Sequence CCTTTTCAAGAAGTTTCTGCAGC TTCTAGGTATAAGATATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 224} {0: 1, 1: 0, 2: 2, 3: 9, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!