ID: 947496050_947496061 |
View in Genome Browser |
Spacer: 10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 947496050 | 947496061 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:230637987-230638009 | 2:230638020-230638042 |
| Sequence | CCTGCCTAGGTGATGACAGGGAG | AAAAAAAGGAGAGGGAGGGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 6, 2: 175, 3: 1540, 4: 7850} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||