ID: 947496050_947496066

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 947496050 947496066
Species Human (GRCh38) Human (GRCh38)
Location 2:230637987-230638009 2:230638027-230638049
Sequence CCTGCCTAGGTGATGACAGGGAG GGAGAGGGAGGGAAGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 100, 4: 726} {0: 2, 1: 59, 2: 533, 3: 3293, 4: 14982}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!