ID: 947496053_947496066

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 947496053 947496066
Species Human (GRCh38) Human (GRCh38)
Location 2:230638011-230638033 2:230638027-230638049
Sequence CCCTGTCCCAAAAAAAGGAGAGG GGAGAGGGAGGGAAGGGGAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 59, 2: 533, 3: 3293, 4: 14982}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!