ID: 947496059_947496067

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 947496059 947496067
Species Human (GRCh38) Human (GRCh38)
Location 2:230638017-230638039 2:230638030-230638052
Sequence CCCAAAAAAAGGAGAGGGAGGGA GAGGGAGGGAAGGGGAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 133, 4: 921} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!