ID: 947523623_947523638

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 947523623 947523638
Species Human (GRCh38) Human (GRCh38)
Location 2:230865836-230865858 2:230865881-230865903
Sequence CCCTGCTCCCCTCTCTTTTCTCC GTCCCCCGACCCCACGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 183, 4: 1619} {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!