ID: 947523625_947523638

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 947523625 947523638
Species Human (GRCh38) Human (GRCh38)
Location 2:230865843-230865865 2:230865881-230865903
Sequence CCCCTCTCTTTTCTCCATTCCCA GTCCCCCGACCCCACGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 113, 4: 1164} {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!