ID: 947534274_947534283

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 947534274 947534283
Species Human (GRCh38) Human (GRCh38)
Location 2:230931175-230931197 2:230931218-230931240
Sequence CCTGGCTCAGTCTTCATCTCCAC CAAGGAGACGTCATTGCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 383} {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!