ID: 947549652_947549671

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 947549652 947549671
Species Human (GRCh38) Human (GRCh38)
Location 2:231037429-231037451 2:231037470-231037492
Sequence CCCGCCCGGGGGCCCGGGGGTCC GGGGCGTGTCCTCTGTGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 382} {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!