|
Left Crispr |
Right Crispr |
Crispr ID |
947567936 |
947567942 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:231207249-231207271
|
2:231207264-231207286
|
Sequence |
CCTCCTGCCTCAGCCTCCCAAAG |
TCCCAAAGTTGTGGGATTGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 25296, 1: 77323, 2: 157079, 3: 168016, 4: 148902} |
{0: 3, 1: 265, 2: 15165, 3: 337369, 4: 260335} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|