ID: 947579597_947579599

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947579597 947579599
Species Human (GRCh38) Human (GRCh38)
Location 2:231306813-231306835 2:231306830-231306852
Sequence CCACACAGAGGATCTGGGCAGTG GCAGTGAGTCTTGAACAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 207} {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!