ID: 947589600_947589608

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 947589600 947589608
Species Human (GRCh38) Human (GRCh38)
Location 2:231378066-231378088 2:231378091-231378113
Sequence CCCCACCCCCAAGAGCCGGTTAT AATGTTTACCAGCACTCCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 15, 3: 59, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!