ID: 947590156_947590162

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 947590156 947590162
Species Human (GRCh38) Human (GRCh38)
Location 2:231380809-231380831 2:231380828-231380850
Sequence CCCAGGGCTCGGGTGCTTCCAGG CAGGGAAATCAGCATTTGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!