ID: 947592978_947592996

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 947592978 947592996
Species Human (GRCh38) Human (GRCh38)
Location 2:231395717-231395739 2:231395770-231395792
Sequence CCCACCCGCCCGCCGTCCCGCCG CGCTCGCCCCTCCGCCGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 465} {0: 1, 1: 0, 2: 1, 3: 11, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!