ID: 947619087_947619094

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 947619087 947619094
Species Human (GRCh38) Human (GRCh38)
Location 2:231577177-231577199 2:231577190-231577212
Sequence CCCCAGCCTGACACCCGGGAAGG CCCGGGAAGGGTCTGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 82, 3: 448, 4: 507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!