ID: 947674074_947674082

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 947674074 947674082
Species Human (GRCh38) Human (GRCh38)
Location 2:231961696-231961718 2:231961727-231961749
Sequence CCGTGACCCGGAAGAGCATTCTC CTGCGGGACTGCGGCGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} {0: 1, 1: 0, 2: 0, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!