ID: 947674076_947674085

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 947674076 947674085
Species Human (GRCh38) Human (GRCh38)
Location 2:231961703-231961725 2:231961736-231961758
Sequence CCGGAAGAGCATTCTCCTTAGCA TGCGGCGGCGCCGGCCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157} {0: 1, 1: 1, 2: 1, 3: 32, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!