ID: 947681701_947681707

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 947681701 947681707
Species Human (GRCh38) Human (GRCh38)
Location 2:232039716-232039738 2:232039768-232039790
Sequence CCTTTGTCAATTGGAATATTAAG GAGAGTTTTTGGCAGAACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 271} {0: 1, 1: 0, 2: 0, 3: 18, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!