ID: 947710729_947710740

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 947710729 947710740
Species Human (GRCh38) Human (GRCh38)
Location 2:232314075-232314097 2:232314109-232314131
Sequence CCCACCTTTCCCTGATTTCCATT GAGCCCTCTGGGCCTGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 123, 4: 1798} {0: 1, 1: 0, 2: 3, 3: 39, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!