ID: 947711585_947711592

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 947711585 947711592
Species Human (GRCh38) Human (GRCh38)
Location 2:232319494-232319516 2:232319516-232319538
Sequence CCACACAGGGCCCTCCTGGGGTG GTTGGGCAAGGCCTCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 328} {0: 1, 1: 0, 2: 1, 3: 24, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!