ID: 947711585_947711593

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 947711585 947711593
Species Human (GRCh38) Human (GRCh38)
Location 2:232319494-232319516 2:232319522-232319544
Sequence CCACACAGGGCCCTCCTGGGGTG CAAGGCCTCCTCCCAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 328} {0: 1, 1: 0, 2: 2, 3: 43, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!