ID: 947711585_947711599

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 947711585 947711599
Species Human (GRCh38) Human (GRCh38)
Location 2:232319494-232319516 2:232319536-232319558
Sequence CCACACAGGGCCCTCCTGGGGTG AGGCAGAGGCAGCTGGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 328} {0: 1, 1: 1, 2: 6, 3: 90, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!