ID: 947741394_947741400

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 947741394 947741400
Species Human (GRCh38) Human (GRCh38)
Location 2:232486577-232486599 2:232486623-232486645
Sequence CCCGCGCCGCAGCGGCTCACGTA AGTGCGCCGTCAGCGAATACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35} {0: 2, 1: 1, 2: 0, 3: 1, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!