ID: 947745197_947745205

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 947745197 947745205
Species Human (GRCh38) Human (GRCh38)
Location 2:232503630-232503652 2:232503653-232503675
Sequence CCCGCGGGTGCCGATAAAGGCGG CTAATTCCCGAGCCCGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!