ID: 947745197_947745210

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 947745197 947745210
Species Human (GRCh38) Human (GRCh38)
Location 2:232503630-232503652 2:232503659-232503681
Sequence CCCGCGGGTGCCGATAAAGGCGG CCCGAGCCCGGGGAGGGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 65, 4: 636}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!