ID: 947749178_947749183

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 947749178 947749183
Species Human (GRCh38) Human (GRCh38)
Location 2:232523905-232523927 2:232523924-232523946
Sequence CCTGGCGCACCAGCAGTGCCTGC CTGCAGCGCCGGCGGCGATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 424} {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!