ID: 947752323_947752326

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 947752323 947752326
Species Human (GRCh38) Human (GRCh38)
Location 2:232539567-232539589 2:232539584-232539606
Sequence CCTGGAACAGCTGACAACGCTGT CGCTGTGGTCAGACAGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87} {0: 1, 1: 0, 2: 3, 3: 16, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!