ID: 947752521_947752525

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 947752521 947752525
Species Human (GRCh38) Human (GRCh38)
Location 2:232540308-232540330 2:232540322-232540344
Sequence CCATTGGTGGCCTGTGGGGACTG TGGGGACTGGCACTGAAGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 197} {0: 1, 1: 0, 2: 2, 3: 11, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!